distributed reproduction

16 02 2008

Starting with the premise of a distributed ontology of reproduction, mapping such a distributed ontology evokes multiple domains that crisscross between organic and technical registers. Thinking about “reproduction” simultaneously from the vantage points of 1) population and aggregate life, often in relation to managing “economy” as an epistemic figure and target of governmentality, 2) digital copying, reassembly, and piracy, and 3) chemical copying, generics, similars in pharmaceutical production.

Reproduction is about multiplications and new designations of legitimate, illegal, or dangerous creations.

Thinking then about reproduction as exceeding its organismic formation and extended into capital formations, I am beginning to question my presumption that “reproduction” necessary best names the object of inquiry. here, a tag cloud comes to mind– a cluster of tightly bound, closely related terms.





Signing Science = Authoring Art?

3 02 2008

Feb 2, 2008

 

The Telegraph today reports : ‘Watermarks’ written in first artificial genome

[By Roger Highfield, Science Editor / Last Updated: 7:55pm GMT 01/02/2008, http://www.telegraph.co.uk/earth/main.jhtml;jsessionid=KEG0KWHGV4PS3QFIQMGSFFWAVCBQWIV0?view=DETAILS&grid=&xml=/earth/2008/02/01/scigenome101.xml ] See footnote below for protein sequences.

 

Lots of interesting things about this report. First, although the “signature” is Craig Venter’s, the first line of the report is of a “team at the J Craig Venter Institute in Rockville, Maryland” which has just  synthesized a bacterium, “creat[ing] the largest man-made DNA structure … as a precursor to breeding a synthetic organism in the lab.”

 

The author function operating here renders “group” as “solo author.” But this is not unusual, everything is business as usual in scientific (especially private lab) research. The reference to Foucault might be worth pursuing, though, as we read through the article and ponder the issue of “signatures” in protein sequences within a patented, synthesised organism.  

 

Watermarks are used on paper money, and also on institutional/ business letterhead paper. They literally signify ownership, authority, supervisory power over the way that document is used and circulated. Signatures are, among other things, valuable markers on works of art that assist the art-commodity market to authenticate artist’s work and to circulate it at its proper exchange value. The work of art is created under the (momentary, fleeting) fantasy that it exists outside the realm of profane economic circulation, but every artist knows the illusory nature of that fantasy. The signature sediments the possibility of art-becoming-commodity.

 

Is this bacterium art, science, and/or commodity, or all simultaneously?

 

Back to Foucault, I am interestedin that claim he originally made that authorship in science was totally different from authorship in writing and art. I’ve always wondered about the validity of that separation and this makes me question it more. 

 

Footnote: The Telegraph report provides the 5 “watermarks” as below. The Telegraph reporter also notes: “This is not the first time Dr Venter has personalised his work. He used his own DNA in a controversial private effort to read the entire human genetic code and finished off the job this year, marking the ultimate feat of autobiography.

The five watermarks:

CRAIGVENTER

 

TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA

 

VENTERINSTITVTE

 

TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA

 

HAMSMITH

 

TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA

 

CINDIANDCLYDE

 

TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTCGAT

GTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG

 

GLASSANDCLYDE

 

TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA

“ 





The Copy

24 01 2008

 

Cori Hayden

Lucy Suchman

 

4S Rotterdam  2008

 

Panel proposal:

 

Mere innovation: Postcolonial and other ruminations on invention and

imitation

Co-organizers:

Cori Hayden (UC Berkeley) and Lucy Suchman (University of Lancaster)

 

Innovation is often defined through its distance from the old, or ‘the

same.’  As such, and by extension, it gains moral, political, and

technical force by its presumed and actively produced contrast with the

merely imitative, or the mere copy.  Even in a moment in which U.S.

corporate models of innovation seem open to growing political and

technical critique, this contrast continues to operate.  For example,

“open source” bioscience consortia, among many other Anglo-European

efforts to reengineer the infrastructures of research, development, and

distribution, actively fetishize innovation, at the expense of the mere

copy.  (Many open source-inspired platforms, in other words, are justified

by their ability to help us build a better mousetrap).  This panel seeks

to make ‘the mere’ interesting by drawing our attention to a range of

engagements with the idea of “the same, with a difference.”  Among other

things, as Ivan da Costa Marques has argued, doing so opens to further

scrutiny the morally and politically charged line between innovation and

the copy which has long organized colonial and post-colonial iterations of

modernity and difference.  It also opens up the space of ‘the copy’ (or of

imitation, similarity, and the substitute – not all the same thing) to

critical reflection, allowing us to examine the many kinds of

technical-political projects undertaken in their name.  Our goal in

‘mere-ing’ innovation is thus not simply to reverse the moral charge– that

is, it is not to restore practices denounced as imitative to their

rightful place in the annals of invention, nor conversely to denounce

declared practices of innovation as (merely) something less impressive.

Rather, we seek to think empirically and historically about how sameness,

similarity, and difference are themselves at stake in a range of sites,

practices, and projects.

 








Follow

Get every new post delivered to your Inbox.