Alchemical production

23 02 2008

Like lots of writers, I often turn to the word “produced” to describe the effects of relations. I used to write “constitute” every other sentence, but rid myself of the bad habit. But “produced” is bothering me these days. As a term, it is tremendously entangled with forms of making in capital formation. Moreover, the more I pay attention to the genealogy of the term “reproduction” the more uncomfortable I become using its relative “produce” so casually. While I don’t mind the implication that capital is part of the story of “making” in the contemporary world, at the same time I think there is another implication, unthought perhaps, at least unanalyzed, that capital precedes the capacity to be made or to act (rather than territorializing capacities in a co-emergent fashion) or that capital is at stake in “the last analysis.

So, I’ve been playing with the idea of drawing on terms for “making” from the days before industrial capitalism. Reproduction is preceded by terms like “generation” which in turn were accompanied by such actions as “fermenting” and “concocting.” I REALLY like “ferment” given its double meaning of making and insurgence.

I’m already very fond of “conjuring” and look forward to the day when I might use the term “miraculate.”

In a more chemical domain, “bind” and “affinity.”

Other possibilities: evoke and invoke, ripen, sympathies, amalgamation, circulation, coagulation, combustion, composition, concoction, corrosion, crystallization, dessication, detonation, digestion, disintegration, distillation, evaporation, extraction, fermentation, filtration, fixation, granulation, ignition, incineration, melting, precipitation, preparation, separation, sublimation, and vitrification.

Thoughts?





Working with affect?

22 02 2008

Typing here, now, is a moment of immaterial labor in an economy of affects. so, the conversations around affective labor would say. I’ve been reading some of this work, and wanted to try out some thoughts about affect. But by affect, here, I do not mean emotion, nor even a property particular to bodies or living being, but more abstractly as the “power to act”. Moreover, this “power to act” is not a given property, but is emergent and evoked in complex, dynamic, historically specific assemblages/relations. The affect, as the power to act, is the power to respond to power. Or put slightly differently, the capacity to respond to capacity. Read the rest of this entry »





Human Capital gets a Journal

19 02 2008

The first issue of this journal is out. It will be interesting to track and see what happens to the concept in light of potential upcoming shifts in U.S. imperialism. No surprise that it comes from Chicago UP, since the term is vintage Chicago school of economics.

For a quick and dirty definition, Gary Becker, one of the Chicago fathers of the term, defines it as the “knowledge, skills, health, or values” invested in and inseparable from humans that makes them productive. As “human capital” has, during Bush’s presidency, become integrated into the development regime of the World Bank, each of the attributes — knowledge, health, values– becomes targets.

Unsurprisingly, the opening issue has an overview of the concept’s history, confirming that “human capital” emerged in relation to two problematics: 1) rural development (via Theodore Shultz) and 2) fertility (via Gary Becker, who has worked in the Bush administration with Rumsfeld’s Defense Policy Board). Both won Nobel Prizes.

Chewing over what is different about the way “human capital” helps to reassemble production and reproduction (compared to, for example, demography) I’m trying to think through the way it shifts how “quality” matters. Read the rest of this entry »





Notes: Heredity as Epistemic Space

18 02 2008

I’ve been reading the edited collection by Staffan Muller-Wille and Hans-Jorg Rheinberger called Heredity Produced: At the Crossroads of Biology, Politics and Culture, 1500-1870. It has been tremendously suggestive, particularly in terms of adding the axis of heredity to the project of historicizing the reproduction/production juncture. In my own research on the process , which I am call the “economization of life,” I’ve been looking at how economic value begins to substitute for “race” as the primary axis for calibrating differential human worth in the era of eugenics, coming to culmination in the era of population control. The multiple genealogies of heredity in Heredity Produced (particularly the introduction) suggest a re-opening of questions about heredity and capital formations, questions which are importantly varied from that of commodified life and biomedical sex reassemblies. Read the rest of this entry »





calculative formations of reproduction

16 02 2008

I’m not sure if this is the precise phrasing, but taking seriously the claim that reproduction has an ontological purchase in its economized form — as a demographic and economic aggregation, measured and brought into recognition through quantitative practices– it seems to follow that one might speak of a calculative ontology within reproduction’s multiple and distributed formation.

This point perhaps provides some opportunity to find other traffic between organic and non organic (production) domains of repro: questions about kinds of “many,” governing of unruly mulitplication, etc.

Another thought too is to think more about the work of substitution that forms of capital, and the performance of substitution in quantitative measures of aggregation. Opening up questions about kinds and forms and sites of substitutions and “exchange” and translation.





distributed reproduction

16 02 2008

Starting with the premise of a distributed ontology of reproduction, mapping such a distributed ontology evokes multiple domains that crisscross between organic and technical registers. Thinking about “reproduction” simultaneously from the vantage points of 1) population and aggregate life, often in relation to managing “economy” as an epistemic figure and target of governmentality, 2) digital copying, reassembly, and piracy, and 3) chemical copying, generics, similars in pharmaceutical production.

Reproduction is about multiplications and new designations of legitimate, illegal, or dangerous creations.

Thinking then about reproduction as exceeding its organismic formation and extended into capital formations, I am beginning to question my presumption that “reproduction” necessary best names the object of inquiry. here, a tag cloud comes to mind– a cluster of tightly bound, closely related terms.





Notes on Working Group meeting

15 02 2008

Tartine Bakery (Feb 2008) was very good for the exchange of productive ideas on technopolitics.

Notes below, posted belatedly some months later (June 2008),  rather fragmented.

THE COPY: [see French OED; "copious"] ; M-C-M

Copy as generative of value? Profit not from innovation but about imitating, copying

Innovation or copying should not be mapped onto stages of growth.

Post-industrial play of signs; Materiality of replication

The vital copy (generic living vaccines)

Generativity in a distributed ontology – allows traffic across domains to crystallize under the sign of reproduction

- what are the domains crystallizing under this sign?

What are the generative formations that are not completely subsumable under teh sign of capital? Gift/hacker? Public domain?

The opposition between Public Domain and private/capitalized domain : these markings always produce their consstitutive outside

Tim Mitchell: essay on de Soto – see Lancaster sociology site “Mystery of Capitalism”

Miranda Joseph – Against the Romance of community; new work on debt

Geeta Patel – work on credit, rish

Baudrillard; Hillel Schwartz; Walter Benjamin; Stengers; Derrida (Given Time); Natalie Zemon Davis (book on gift giving);  Mbembe (Necropolitics; superfluity)

Time and Accumulation: standard model of scientific truth (philosophy of science; recall Sandra Harding’s critique of objectivity as masculinist, what is the next round of feminist critiques of objectivity that dont take us down the standpoint road?)

Surplus, Excess: valuations of multiplicity

Death: Last chapter of Dolly book (on culling); Kathy High on lab rats

Cori: Clinical trials mobilize populations as resources; testing is crucial to figuring epidemiology





Signing Science = Authoring Art?

3 02 2008

Feb 2, 2008

 

The Telegraph today reports : ‘Watermarks’ written in first artificial genome

[By Roger Highfield, Science Editor / Last Updated: 7:55pm GMT 01/02/2008, http://www.telegraph.co.uk/earth/main.jhtml;jsessionid=KEG0KWHGV4PS3QFIQMGSFFWAVCBQWIV0?view=DETAILS&grid=&xml=/earth/2008/02/01/scigenome101.xml ] See footnote below for protein sequences.

 

Lots of interesting things about this report. First, although the “signature” is Craig Venter’s, the first line of the report is of a “team at the J Craig Venter Institute in Rockville, Maryland” which has just  synthesized a bacterium, “creat[ing] the largest man-made DNA structure … as a precursor to breeding a synthetic organism in the lab.”

 

The author function operating here renders “group” as “solo author.” But this is not unusual, everything is business as usual in scientific (especially private lab) research. The reference to Foucault might be worth pursuing, though, as we read through the article and ponder the issue of “signatures” in protein sequences within a patented, synthesised organism.  

 

Watermarks are used on paper money, and also on institutional/ business letterhead paper. They literally signify ownership, authority, supervisory power over the way that document is used and circulated. Signatures are, among other things, valuable markers on works of art that assist the art-commodity market to authenticate artist’s work and to circulate it at its proper exchange value. The work of art is created under the (momentary, fleeting) fantasy that it exists outside the realm of profane economic circulation, but every artist knows the illusory nature of that fantasy. The signature sediments the possibility of art-becoming-commodity.

 

Is this bacterium art, science, and/or commodity, or all simultaneously?

 

Back to Foucault, I am interestedin that claim he originally made that authorship in science was totally different from authorship in writing and art. I’ve always wondered about the validity of that separation and this makes me question it more. 

 

Footnote: The Telegraph report provides the 5 “watermarks” as below. The Telegraph reporter also notes: “This is not the first time Dr Venter has personalised his work. He used his own DNA in a controversial private effort to read the entire human genetic code and finished off the job this year, marking the ultimate feat of autobiography.

The five watermarks:

CRAIGVENTER

 

TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA

 

VENTERINSTITVTE

 

TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA

 

HAMSMITH

 

TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA

 

CINDIANDCLYDE

 

TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTCGAT

GTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG

 

GLASSANDCLYDE

 

TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA

“